Crea tu cuenta gratis y disfruta de una semana de videos de primera calidad en PornHub Premiun

Mi señora la cachonda

Adriana y yo estamos casados hace como 4, salimos durante 6 años, e hicimos muchas cosas en el sexo.

Una vez estábamos tan calientes que fuimos a un hotel. Ella me empezó desnudar y a tocar mi pene, lo tocaba por encima hasta que lo saco del pantalón y del boxer, estaba a mil mi pene UUUUFUFUFUFUFUF lo sobaba como una diosa, hasta que se lo metió todo en la boca lo chupaba en un mete y saca de la boca, mortal, le ponía saliva y dejaba que cayera, eso me calentaba un montón, de pronto sentí que me sobaba el culo, los cachetes y de repente, el ano, sentí como me comenzó a masajear el ano, estaba súper rico lo que hacia, me lo chupaba completo y me masajeaba el hoyo, hasta que comenzo a meterme un dedo dentro UUUUUUFUFFFFFFFFF ue calentura, y me pidio que me sacar toda la ropa, de inmediato le dije que si, y ella se empezo a desnudar de forma muy senxual, hasta quedar desnuda por completo, y comenzo a mansturbarse frenrte a mi, GFGGGGGGGGUUUUUUUAAAAAAUUUU me pidio que saliera de la cama para que ella estuviera ahí, se estiro abrio sus piernas y comenzo a manstrurbasre metia dos dedos de inmediato su vagina estaba mojada entera y comenzo a chuparse los dedos los metia y sacaba sus jugos con los dedos y os chupaba, no aguante mas y le comence a chupar su vagina que tenia una mata de pelo suave que dejaba ver sus labios y su clítoris comenzo a ghritar y vino su primer orgasmo.

No deje de chuparla y la di vuelta con su boca para abajo, puse un cojin en su abdomen y de abru su culo y comense a chuparselo le gustaba un monton grutaza para que se lo metiera por rl culo, yo espere un poco queria seguir chupando ese culo, me encata ese sabor creo que es mejor que la vagina….., pe pare y le meti de apoco i pene ella comenzo a tirarse para atrás en un mete y saca que ella llebaba a perfeccion, hsta que me corri dentro de ella, , se dio vuelta de inmediarto y me lo chupo hasta que no quedo ni una gota.

En el proximo fin de semana, ella me dijo que queria que le chupara el culo, yo le dije porque no, le baje los pantalones en la cocina y comence a lamerle el hoyo, no paraba de gritar y me decia DELE MI PERRITO CUPAME EL ANO,,,,,,,DSE QUE TE GUSTA eso me puso a mil y como veia que le gusta le dije, ven y chupame mi culo, me bajo los pantalones y el box, y me comenzo a dar la mejor chupada, me la lleve al living y le comence a meter mi pene por la boca, la di vuelta y mi pobjetivo era su vagina, la puse encima mio y de pronto vemos que se habre la puerta del la casa, era un amigop al cual le arrebdamis una habitación, al verlos seguimos en lo nuestro el cerro u se sento en el sofa del frente y saco su pene y comenzo masnturbarse, yo le dije con un ojo que se acercara, se saco los pantalones y le puso el pene en la cara de adriana, y mi mujer se puso a cuparle el pene de funa forma mortal, y me miraba y me decia TE GUSTA QUE SE LO CHUPE A IVAN………..yo le respondia que si….era una pñuta……deje que le siguiera chuipando la polla y yo me la empece a follar por el culo y me pedia mas me decia ROMPEME EL CULO PERRO, DALE….

No agunate mas y le tite toda mi leche eb su cara, ivan hizo lo mismo………………..

De ves en cuando encuentro a adriana chupandole el pene a ivan en el living dice que es para relajarse yo la dejo.

Erspero que les haya gustado mi historia,,,bvale la pena casarse

Mejora la calidad y duracion de tus erecciones con Vigrax


Deja un comentario

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *

*